View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9853_high_18 (Length: 248)
Name: NF9853_high_18
Description: NF9853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9853_high_18 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 65; Significance: 1e-28; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 66 - 167
Target Start/End: Original strand, 30743303 - 30743412
Alignment:
| Q |
66 |
atatatatccaacttttttgttttggcactcacatatatatccaacttatcatgtc--------attagtaatttatattttatcagtgccctatttttt |
157 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||| || |||||| |
|
|
| T |
30743303 |
atatatatccaacttttttgttttggcaatcacatatatatccaacttatcatgtcctcaatatgttagtaatttatattttatcagtgcgctgtttttt |
30743402 |
T |
|
| Q |
158 |
aatgggcgcg |
167 |
Q |
| |
|
|||||||||| |
|
|
| T |
30743403 |
aatgggcgcg |
30743412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 13 - 73
Target Start/End: Original strand, 30743214 - 30743274
Alignment:
| Q |
13 |
aaatatattatcgatgtacacaaattaaattctaataaaaatacttacattacatatatat |
73 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30743214 |
aaatatattatcggtgcacacaaattaaattctaataaaaatacttacattacatatatat |
30743274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 195 - 242
Target Start/End: Original strand, 30743635 - 30743682
Alignment:
| Q |
195 |
ttttaatggacgctggttaattattttgtgtacttgaactctctgctt |
242 |
Q |
| |
|
||||| |||||| ||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
30743635 |
ttttagtggacgatggttaattgttttgtgtacttgaactctttgctt |
30743682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University