View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9853_high_22 (Length: 240)
Name: NF9853_high_22
Description: NF9853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9853_high_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 24247112 - 24247332
Alignment:
| Q |
1 |
attatctttggttatcatagttaaggcttttagagtgaaattattattaacaatactatgcgatttgtgtttccttgtgaatttaaaggatgcatatgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24247112 |
attatctttggttatcatagttaaggcttttagagtgaaattattattaacaatactatgcgatttgtgtttccttgtgaatttaaaggatgcatatgga |
24247211 |
T |
 |
| Q |
101 |
tctcgtgtttggtttcttcaagaatgcatgtcacatgcttagggccaacggtgagattcatgtcaatcacaaaactacacctcctttcaatgactggaac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
24247212 |
tctcgtgtttggtttcttcaagaatgcatgtcacatgcttagggccaacggtgagattcatgtcaatcacaaaactacacctcctttcattgactggaac |
24247311 |
T |
 |
| Q |
201 |
attgagaagctcgccaagcaa |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
24247312 |
attgagaagctcgccaagcaa |
24247332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 110 - 187
Target Start/End: Original strand, 24243382 - 24243459
Alignment:
| Q |
110 |
tggtttcttcaagaatgcatgtcacatgcttagggccaacggtgagattcatgtcaatcacaaaactacacctccttt |
187 |
Q |
| |
|
||||||||||||||||||| |||||||||| | | |||| | |||||||||||| ||||||||||| | ||||||||| |
|
|
| T |
24243382 |
tggtttcttcaagaatgcaagtcacatgctaatgaccaatgatgagattcatgtgaatcacaaaacaaaacctccttt |
24243459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University