View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9853_low_18 (Length: 415)
Name: NF9853_low_18
Description: NF9853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9853_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 1 - 402
Target Start/End: Original strand, 34673934 - 34674350
Alignment:
| Q |
1 |
ctttttctatctctttccctttgcatatctctcttccaattagggtttcctctttaagggtatagtgctcctcatctaataaatctacgtgatcttttac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34673934 |
ctttttctatctctttccctttgcatatctctcttccaattagggtttcctctttaagggtatagtgctcctcatctaataaatctacgtgatcttttac |
34674033 |
T |
|
| Q |
101 |
ttctcattagctaaggctatttannnnnnn-cttgtgaaggtacaagaacagattcaaaaaaggtacttcccttttagtaattctcctgatcaaagaaac |
199 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34674034 |
ttctcattagctaaggctattttttttttctctcgtgaaggtacaagaacagattcaaaaaaggtacttcccttttagtaattctcctgatcaaagaaac |
34674133 |
T |
|
| Q |
200 |
ctacatatcacaaacaggtaaaatcatgttcatgtagttagcttccctcttttctttatgcata-----------tttctatgatttgtgctcttttgag |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34674134 |
ctacatatcacaaacaggtaaaatcatgttcatgtagttagcttccctcttttctttatgcatatatttagttcttttctatgatttgtgctcttttgag |
34674233 |
T |
|
| Q |
289 |
taaagtaacggttgcttgacataaaatggatccttttgaaaagacactatttagggctttgcccaatttctatgcttttatttt---atgatgtagttct |
385 |
Q |
| |
|
||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| ||||||||||||| |
|
|
| T |
34674234 |
taaggtaacggttgcttgacacaaaatggatccttttgaaaagacactatttagggctttgcccaatttatatgcctttattttatgatgatgtagttct |
34674333 |
T |
|
| Q |
386 |
ttgctgcagccagatct |
402 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
34674334 |
ttgctgcagccagatct |
34674350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 193 - 234
Target Start/End: Original strand, 43582157 - 43582196
Alignment:
| Q |
193 |
aagaaacctacatatcacaaacaggtaaaatcatgttcatgt |
234 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43582157 |
aagaaacctacat--cacaaacaggtaaaatcatgttcatgt |
43582196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University