View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9853_low_28 (Length: 332)
Name: NF9853_low_28
Description: NF9853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9853_low_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 20 - 326
Target Start/End: Complemental strand, 14414527 - 14414221
Alignment:
| Q |
20 |
tcatgcacagacacaatagcattttcagttaacgaaggaatgttcctttccggattacctcgtacagctccccttggaggccgtagagatgcgctctatt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14414527 |
tcatgcacagacacaatagcattttcagttaacgaaggaatgttcctttccggattacctcgtacagctccccttggaggccgtagagatgcgctctatt |
14414428 |
T |
 |
| Q |
120 |
ccctagcatctattgcggaagacgacaaccttccaatgcctaattggccgatggaaaaaatggttgacctctttacnnnnnnnggtttcacaattgaaga |
219 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
14414427 |
ccctagcatctatcgcggaagacgacaaccttccaatgcctaattggccgatggaaaaaatggttgacctcttcacaaaaaaaggtttcacaattgaaga |
14414328 |
T |
 |
| Q |
220 |
aatggttattttacttggtgcgcattcaattggtgtggctcattgcgatgtttttatggaaaggatttacaattacgcagacacgaggaaacctgatcct |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14414327 |
aatggttattttacttggtgcgcattcaattggtgtggctcattgcgatgtttttatggaaaggatttacaattacgcagacacgaggaaacctgatcct |
14414228 |
T |
 |
| Q |
320 |
ttgcttc |
326 |
Q |
| |
|
||||||| |
|
|
| T |
14414227 |
ttgcttc |
14414221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University