View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9853_low_31 (Length: 321)
Name: NF9853_low_31
Description: NF9853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9853_low_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 92; Significance: 1e-44; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 18 - 120
Target Start/End: Complemental strand, 3920972 - 3920869
Alignment:
| Q |
18 |
gaattgactagaacttagaattcatgatcttttatcatccaatcatc-tttgatcattcaaactataaatacaatggaaatatgtcatagtagctatgat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3920972 |
gaattgactagaacttagaattcatgatcttttatcatccaatcatcctttgatcattcaaactataaatacaacggaaatatgtcatagtagctatgat |
3920873 |
T |
 |
| Q |
117 |
gata |
120 |
Q |
| |
|
|||| |
|
|
| T |
3920872 |
gata |
3920869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 60 - 144
Target Start/End: Original strand, 33425648 - 33425735
Alignment:
| Q |
60 |
tcatctttgatcattcaaac-tataaatacaatggaaatatgtcatagtagctatgatgatactcaa--cctaattatctaatattta |
144 |
Q |
| |
|
|||||||||||| || |||| || |||| |||||||||| ||||| ||||||| ||| ||||||| ||||||||||||||||||| |
|
|
| T |
33425648 |
tcatctttgatcttttaaacctacaaatgtaatggaaataggtcatggtagctacaatgctactcaaaacctaattatctaatattta |
33425735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University