View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9853_low_32 (Length: 310)
Name: NF9853_low_32
Description: NF9853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9853_low_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 18 - 298
Target Start/End: Complemental strand, 40809545 - 40809265
Alignment:
| Q |
18 |
gatttcaatggatgatgaattgaacggtgaaatcaacgatgtgtatctcgttgttctaccaatgtttcatgtgtttggacttgcggtgataacgtattcg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40809545 |
gatttcaatggatgatgaattgaacggtgaaatcaacgatgtgtatctcgttgttctaccaatgtttcatgtgtttggacttgcggtgataacgtattcg |
40809446 |
T |
|
| Q |
118 |
cagcttcagagagggaatgcgattgtttcgttgaagcggtttgagtttgaagtggttttgaaaacgattgagaagtttagggttacgagattatggattg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40809445 |
cagcttcagagagggaatgcgattgtttcgttgaagcggtttgagtttgaagtggttttgaaaacgattgagaagtttagggttacgagattatggattg |
40809346 |
T |
|
| Q |
218 |
tgccaccgattgtactcgctctagcgaaacatggtttggttgataagtatgatctttcgagtttgaagtatattggttctg |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40809345 |
tgccaccgattgtactcgctctagcgaaacatggtttggttgataagtatgatctttcgagtttgaagtatattggttctg |
40809265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University