View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9853_low_35 (Length: 300)
Name: NF9853_low_35
Description: NF9853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9853_low_35 |
 | |
|
| [»] scaffold0126 (2 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 24 - 290
Target Start/End: Complemental strand, 24978834 - 24978570
Alignment:
| Q |
24 |
tctatgttatgtcttcaagttacggttacgactatgacatcacacagatatgggtttcaaaatgtatctttggatgaagattatatcaatgagggacact |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24978834 |
tctatgttatgtcttcaagttacggttacgactatgacatcacacagatatgggtttcaaaatgtatctttggatgaagattatatcaatgagggacact |
24978735 |
T |
|
| Q |
124 |
aatatcttccatagtctcacgtgtttatgttcaatgtcacattgttcatttagtaacttcgatataaattcaatgattaattaatatcttcattgattta |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24978734 |
aatatcttccatagtctcacgtgtttatgttcaatgtcacattgttcatttagtaacttcgatataaattcaatgattaattaatatcttcattgattt- |
24978636 |
T |
|
| Q |
224 |
aatatgaatcacaaacaaccatgaaatatatcttatcgtgcaacttgtccttatattggtacctttg |
290 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24978635 |
-acatgaatcacaaacaaccatgaaatatatcttatcgtgcaacttgtccttatattggtacctttg |
24978570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0126 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: scaffold0126
Description:
Target: scaffold0126; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 24 - 101
Target Start/End: Original strand, 21153 - 21230
Alignment:
| Q |
24 |
tctatgttatgtcttcaagttacggttacgactatgacatcacacagatatgggtttcaaaatgtatctttggatgaa |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
21153 |
tctatgttatgtcttcaagttacggttacgaccatgacatcacatagatatgggtttcaaaatgtatctttggatgaa |
21230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0126; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 148 - 288
Target Start/End: Original strand, 21232 - 21384
Alignment:
| Q |
148 |
ttatgttcaatgtcacattgttcatttagtaacttcgata----------taaattcaatgattaattaatatcttcattgatttaaatatgaatcacaa |
237 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| | |||| |||||||||||||||||||||||||||||| |||| | ||||||||||| |
|
|
| T |
21232 |
ttatgttccatgtcacattgttcatttagtaaccttgatactcaatgttataaattcaatgattaattaatatcttcattcattt--acatgaatcacaa |
21329 |
T |
|
| Q |
238 |
acaaccatgaaatatatctta----tcgtgcaacttgtccttatattggtacctt |
288 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
21330 |
acaaccatgaaagatatcttaaaggtcgtgcaacttgtccttatattggtacctt |
21384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University