View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9853_low_36 (Length: 297)
Name: NF9853_low_36
Description: NF9853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9853_low_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 112 - 289
Target Start/End: Complemental strand, 44130076 - 44129899
Alignment:
| Q |
112 |
accctagctacttcaatattccagtttcaacaacttgattatataaagagtgaagagagtagggtctatagtgtttgctgctaagatccaactatactca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44130076 |
accctagctacttcaatattccagtttcaacaacttgattatataaagagtgaagagagtagggtctatagtgtttgctgctaagatccaactatactca |
44129977 |
T |
 |
| Q |
212 |
tcaactcttggggaatcaagcgtctcggtccgatccgtttatgctttttgttataattaatattccatttcctttgct |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44129976 |
tcaactcttggggaatcaagcgtctcggtccgatccgtttatgctttttgttataattaatattccatttccattgct |
44129899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 8 - 69
Target Start/End: Complemental strand, 44130189 - 44130128
Alignment:
| Q |
8 |
ccaccaaacctttgctaatgatgatcatcatccccttcaccatcacaaatacttccactcaa |
69 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44130189 |
ccaccaaacttttgctaatgatgatcatcatccccttcaccatcacaaatacttccactcaa |
44130128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University