View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9853_low_45 (Length: 269)
Name: NF9853_low_45
Description: NF9853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9853_low_45 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 14 - 246
Target Start/End: Original strand, 54395247 - 54395479
Alignment:
| Q |
14 |
aagcaaagggtagaatcagagagtttagtagtggatgcagagatgttgttggaaagcatagagaagctacataactgattaaagcacatatatgaggtta |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
54395247 |
aagcaaagggtagaatcagagagtttagtagtggatgcagagatgttgttggaaagcatagagaagctacataactgattaatgcacatatatgaggtta |
54395346 |
T |
|
| Q |
114 |
gtcgtgcgttgtagaattttgaactgattttgtatgtgcgcaatggtggcatatgtaacattgaaattagtgagaatcatcttgattgagtgatggatag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54395347 |
gtcgtgcgttgtagaattttgaactgattttgtatgtgcgcaatggtggcatatgtaacattgaaattagtgagaatcatcttgattgagtgatggatag |
54395446 |
T |
|
| Q |
214 |
gtatacttctttgtagtgtgctaaggttaatgc |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
54395447 |
gtatacttctttgtagtgtgctaaggttaatgc |
54395479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University