View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9853_low_47 (Length: 267)
Name: NF9853_low_47
Description: NF9853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9853_low_47 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 112; Significance: 1e-56; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 4 - 151
Target Start/End: Original strand, 1373009 - 1373156
Alignment:
| Q |
4 |
gatagcaattgacatgaggaattaacacagttcccatttaccttgtttgccgacataagtccacaagcattgcagagggttcttggcccttcaggtccac |
103 |
Q |
| |
|
|||| |||||||||||| |||||||| |||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1373009 |
gataacaattgacatgaataattaacatagttcccatttaccttatttgcccacataagtccacaagcattgcagagggttcttggcccttcaggtccac |
1373108 |
T |
|
| Q |
104 |
gccgcatcattggcgtgcacttctcactgatgccacaatgcctacaac |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
1373109 |
gccgcatcattggcgtgcacttctcactgatgttacattgcctacaac |
1373156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 55 - 144
Target Start/End: Original strand, 1384869 - 1384958
Alignment:
| Q |
55 |
gacataagtccacaagcattgcagagggttcttggcccttcaggtccacgccgcatcattggcgtgcacttctcactgatgccacaatgc |
144 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1384869 |
gacatgagtccacaagcattgcagagggttcttggcccttcaggtccacgccgcatcattggcgtgcacttctcactgatgccacaatgc |
1384958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 195 - 251
Target Start/End: Original strand, 1385505 - 1385561
Alignment:
| Q |
195 |
ttcaatgcagacaaatattcgaaacaagttcaatctaaaaataatgatagtaagaac |
251 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1385505 |
ttcaacgcagacaaatattcgaaacaagttcaatctaaaaataatgttagtaagaac |
1385561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 148 - 177
Target Start/End: Original strand, 1385480 - 1385509
Alignment:
| Q |
148 |
caaccaaaagcatttacgaatataattcaa |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
1385480 |
caaccaaaagcatttacgaatataattcaa |
1385509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University