View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9853_low_60 (Length: 241)
Name: NF9853_low_60
Description: NF9853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9853_low_60 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 5335234 - 5335351
Alignment:
| Q |
1 |
cgaatcgatccgaaaaatctgccgcgggaacatgattccggtatggaatttcttcgtaacgcgtgcgaaatcggagaaaactgtgaggaatgtgaggagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5335234 |
cgaatcgatccgaaaaatctgccgcgggaacatgattccggtatggaatttcctcgtaacgcgtgcgaaatcggagaaaactgtgaggaatgtgaggagg |
5335333 |
T |
 |
| Q |
101 |
aatattacggttcacggt |
118 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
5335334 |
aatattacggttcacggt |
5335351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 193 - 223
Target Start/End: Original strand, 5335426 - 5335456
Alignment:
| Q |
193 |
ttcggtgaagaaggaggttgagaggttgagg |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
5335426 |
ttcggtgaagaaggaggttgagaggttgagg |
5335456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University