View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9853_low_69 (Length: 217)
Name: NF9853_low_69
Description: NF9853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9853_low_69 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 18 - 200
Target Start/End: Complemental strand, 44627516 - 44627334
Alignment:
| Q |
18 |
acaagtaacgtaagggcatagttgtgagatctcttgatgtcattatagttctgaccttgtgctgccatttcctactcaaacttctcaaaactttgtagac |
117 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44627516 |
acaagtgacgcaagggcatagttgtgagatctcttgatgtcattatagttctgaccttgtgctgccatttcctactcaaacttctcaaaactttgtagac |
44627417 |
T |
|
| Q |
118 |
caagtctacctacattaggaatccttttccccaatgaagcaagatggttaacaagatcataaaaccgcatttgcatatcgtct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44627416 |
caagtctacctacattaggaatccttttccccaatgaagcaagatggttaacaagatcataaaaccgcatttgcatatcgtct |
44627334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 28 - 196
Target Start/End: Complemental strand, 26080738 - 26080574
Alignment:
| Q |
28 |
taagggcatagttgtgagatctcttgatgtcattatagttctgaccttgtgctgccatttcctactcaaacttctcaaaactttgtagaccaagtctacc |
127 |
Q |
| |
|
|||| ||||||||| || |||| ||||| || |||||| ||||||||||||| |||||||| ||||||||| ||||||||||||| ||||| ||| | |
|
|
| T |
26080738 |
taagagcatagttgggaaatctattgatttcgttatagctctgaccttgtgccgccatttcttactcaaacatctcaaaactttgctaaccaaatcttc- |
26080640 |
T |
|
| Q |
128 |
tacattaggaatccttttccccaatgaagcaagatggttaacaagatcataaaaccgcatttgcatatc |
196 |
Q |
| |
|
|||||||||| |||| ||||| ||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
26080639 |
---attaggaatctttttacccaacgaagcaagatgattaacaacatcataaaaccgcatttgcatatc |
26080574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University