View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9854_high_2 (Length: 262)
Name: NF9854_high_2
Description: NF9854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9854_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 18 - 249
Target Start/End: Complemental strand, 49832639 - 49832408
Alignment:
| Q |
18 |
atcttgaccttacctataatgcacctggcgcaaaagattacattcacaaaggtgggatgaaaagagatgtgccacttttggaggatgtggtagtaattga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49832639 |
atcttgaccttacctataatgcacctggcgcaaaagattacattcacaaaggtgggatgaaaagagatgtgccacttttggaggatgtggtagtaattga |
49832540 |
T |
 |
| Q |
118 |
aggggcagggcacttcatccatcaagaaagggctgataagatcaacacatacatttacgatttcttcaaaaaattctaatttgctctgggtttgcatctg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49832539 |
aggggcagggcacttcatccatcaagaaagggctgataagatcaacacatacatttacgatttcttcaaaaaattctaatttgctctgggtttgcatctt |
49832440 |
T |
 |
| Q |
218 |
cctcttaatctgttcctgctcagatggcatct |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
49832439 |
cctcttaatctgttcctgctcagatggcatct |
49832408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University