View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9854_high_6 (Length: 229)
Name: NF9854_high_6
Description: NF9854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9854_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 7 - 196
Target Start/End: Complemental strand, 38375591 - 38375402
Alignment:
| Q |
7 |
gattcatggtttaatattgaaatgttgatgccgattagttgcttgaattaaactaagtatcattaatacttagtctccatatacttcgtgaaaacgttct |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38375591 |
gattcatggtttaatattgaaatgttgatgccgattagttgcttgaattaaactaagtatcattaatacttagtctccatatacttcgtgaaaacattct |
38375492 |
T |
|
| Q |
107 |
ctattctgatgaagagaagatgaaatgatagctagggctgatgcattttttgaaacactgaaaataattcttccgtcatttttattgttt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38375491 |
ctattctgatgaagagaagatgaaatgatagctagggctgatgcattttttgaaacactgaaaataattcttccgtcatttttattgttt |
38375402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 12574063 - 12573998
Alignment:
| Q |
113 |
tgatgaagagaagatgaaatgatagctagggctgatgcattttttgaaacactgaaaataattctt |
178 |
Q |
| |
|
||||| ||||||||||||||| |||||| || |||||||||| | |||| | |||||| ||||||| |
|
|
| T |
12574063 |
tgatggagagaagatgaaatgctagctatggatgatgcatttatggaaataatgaaaacaattctt |
12573998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University