View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9854_low_4 (Length: 311)
Name: NF9854_low_4
Description: NF9854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9854_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 98; Significance: 3e-48; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 11 - 112
Target Start/End: Original strand, 8055818 - 8055919
Alignment:
| Q |
11 |
aagcaaaggactgatgcaaaggatccaactgttaatatatcatatcattattatacaaacctcaattattattataacaaaagatttactttgctatgtg |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8055818 |
aagcataggactgatgcaaaggatccaactgttaatatatcatatcattattatacaaacctcaattattattataacaaaagatttactttgctatgtg |
8055917 |
T |
 |
| Q |
111 |
at |
112 |
Q |
| |
|
|| |
|
|
| T |
8055918 |
at |
8055919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University