View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9856_low_23 (Length: 274)
Name: NF9856_low_23
Description: NF9856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9856_low_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 94 - 257
Target Start/End: Complemental strand, 14176203 - 14176040
Alignment:
| Q |
94 |
tgtggtttgaacagcttctccccaaaatggctttggcagcttagccattttcagcatacatctcactttctccataatggttctgttgattctttcagct |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14176203 |
tgtggtttgaacagcttctccccaaaatggctttggcagcttagccattttcagcatacatctcactttctccataatggttctgttgattctttcagct |
14176104 |
T |
|
| Q |
194 |
acaccattatgttgtggggtgccaggaaccgtcttctcatgtctgatgccgtgctcagaacaat |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14176103 |
acaccattatgttgtggggtgccaggaaccgtcttctcatgtctgatgccgtgctcagaacaat |
14176040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 94 - 257
Target Start/End: Original strand, 28609674 - 28609837
Alignment:
| Q |
94 |
tgtggtttgaacagcttctccccaaaatggctttggcagcttagccattttcagcatacatctcactttctccataatggttctgttgattctttcagct |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28609674 |
tgtggtttgaacagcttctccccaaaatggctttggcagcttagccattttcagcatacatctcactttctccataatggttctgttgattctttcagct |
28609773 |
T |
|
| Q |
194 |
acaccattatgttgtggggtgccaggaaccgtcttctcatgtctgatgccgtgctcagaacaat |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28609774 |
acaccattatgttgtggggtgccaggaaccgtcttctcatgtctgatgccgtgctcagaacaat |
28609837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 94 - 257
Target Start/End: Complemental strand, 12932933 - 12932770
Alignment:
| Q |
94 |
tgtggtttgaacagcttctccccaaaatggctttggcagcttagccattttcagcatacatctcactttctccataatggttctgttgattctttcagct |
193 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12932933 |
tgtggtttgaacagcttctacccaaaatggctttggcagcttagccattttcagcatacatctcactttctccataatggttctgttgattctttcagct |
12932834 |
T |
|
| Q |
194 |
acaccattatgttgtggggtgccaggaaccgtcttctcatgtctgatgccgtgctcagaacaat |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
12932833 |
acaccattatgttgtggggtgccaggaaccgtcttctcatgtctgatgtcgtgctcagaacaat |
12932770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 99 - 257
Target Start/End: Complemental strand, 15298718 - 15298560
Alignment:
| Q |
99 |
tttgaacagcttctccccaaaatggctttggcagcttagccattttcagcatacatctcactttctccataatggttctgttgattctttcagctacacc |
198 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
15298718 |
tttgaacagcttcaccccaaaatggctttggcagcttagccattttcagcatacatctcactttctccataatggttatgttgattctttcagctacacc |
15298619 |
T |
|
| Q |
199 |
attatgttgtggggtgccaggaaccgtcttctcatgtctgatgccgtgctcagaacaat |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
15298618 |
attatgttgtggggtgccaggaaccgtcttctcatgtctgatgtcgtgctcaaaacaat |
15298560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 116 - 248
Target Start/End: Original strand, 38995353 - 38995485
Alignment:
| Q |
116 |
caaaatggctttggcagcttagccattttcagcatacatctcactttctccataatggttctgttgattctttcagctacaccattatgttgtggggtgc |
215 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||| | |||||| ||||||||| ||||||||||||| | ||||||||| |||| ||||||| |
|
|
| T |
38995353 |
caaaatggcttaggcaacttagccattttcagcatacatctaattttctctataatggttttgttgattctttctgttacaccattttgttatggggtgt |
38995452 |
T |
|
| Q |
216 |
caggaaccgtcttctcatgtctgatgccgtgct |
248 |
Q |
| |
|
|| | |||||||||||||||| |||| |||| |
|
|
| T |
38995453 |
tagataacgtcttctcatgtctggtgccctgct |
38995485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University