View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9856_low_27 (Length: 256)
Name: NF9856_low_27
Description: NF9856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9856_low_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 253
Target Start/End: Complemental strand, 31352220 - 31351966
Alignment:
| Q |
1 |
aatgcaatatgaattattgtaaatgcttcaatgcaacaattcaagaaaaatgatgtagaataattggttcactcttgtcttccaatttatttctcttagc |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31352220 |
aatgcaatatgaattattctaaatgcttcaatgcaacaattcaagaaaaaagatgtagaataattggttcactcttgtcttccaatttatttctcttagc |
31352121 |
T |
 |
| Q |
101 |
atctggtatgttctcatagcataaagaatcaaatactctaaa--atgagtgacatcatgctttccttctaaccaccctttctcatgaaccattgtcttca |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31352120 |
atctggtatgttctcatagcataaagaatcaaatactctaaaatatgagtgacatcatgctttccttctaaccaccctttctcatgaaccattgtcttca |
31352021 |
T |
 |
| Q |
199 |
acttcttattaggacattttttcaagatttaagttgcagtgatctctgcttctcc |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
31352020 |
acttcttattaggacattttttcaagatttaagttgcagtgatcactgcttctcc |
31351966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University