View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9856_low_34 (Length: 249)
Name: NF9856_low_34
Description: NF9856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9856_low_34 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 33 - 249
Target Start/End: Complemental strand, 22519953 - 22519737
Alignment:
| Q |
33 |
atgtttagatctcgcatattcatggcatgttgaagctcattctctttaattattgtactccttttgtataagacatttatggcccaatagttttcattat |
132 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22519953 |
atgtttagatctcgcttattcatggcatgttgcagctcattttctttaattatagtactccttttgtataagacatttatggcccaatagttttcattag |
22519854 |
T |
 |
| Q |
133 |
agcttcttcgaaaatatttgtagaaactttttgttgtctgtgtaataaggtagatgaaaatttcaaatctttgaataatttaagtacacttagtactata |
232 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
22519853 |
agtttcttcgaaaatatttgtagaaactttttgttgtcaatgtagtaaggtagatgaaaatttaaaatctttgaataatttaagtacacttagtactata |
22519754 |
T |
 |
| Q |
233 |
tcaataatctatgcttc |
249 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
22519753 |
tcaataatctatgcttc |
22519737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University