View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9856_low_40 (Length: 238)
Name: NF9856_low_40
Description: NF9856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9856_low_40 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 14 - 227
Target Start/End: Complemental strand, 32850123 - 32849910
Alignment:
| Q |
14 |
gaagcatctttcggttctgaacttctacgacaactcctacgatttcctacaacattccaaacgatttagaagctttgctctcttagttaacggtgtgctc |
113 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32850123 |
gaagcatctttcggttctgaacttctgcgacaactcctacgatttccaaggacattccaaacgatttagaagctttgctctcttagttaacggtgtgctc |
32850024 |
T |
|
| Q |
114 |
gggacttttctccatactccccacaccattcagaagtttagtctcaactgcgctcattcctttttgaacgacaggttccgtgcctgttcagttgacacgt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32850023 |
gggacttttctccatactccccacaccattcagaagtttagtctcaactgcgctcattcctttttgaacgacaagttccgtgcctgttcagttgacacgt |
32849924 |
T |
|
| Q |
214 |
gggttcgtaccgcc |
227 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
32849923 |
gggttcgtaccgcc |
32849910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 63 - 227
Target Start/End: Complemental strand, 4413939 - 4413775
Alignment:
| Q |
63 |
caacattccaaacgatttagaagctttgctctcttagttaacggtgtgctcgggacttttctccatactccccacaccattcagaagtttagtctcaact |
162 |
Q |
| |
|
||||||||||||| ||| | |||||| |||||||||||| ||||||||||| | |||||| | | |||| ||||||||| ||||||| |||| | | |
|
|
| T |
4413939 |
caacattccaaactattcaaaagcttcgctctcttagtttacggtgtgctcatggcttttcccggtgctccgcacaccattaagaagttccatctcgagt |
4413840 |
T |
|
| Q |
163 |
gcgctcattcctttttgaacgacaggttccgtgcctgttcagttgacacgtgggttcgtaccgcc |
227 |
Q |
| |
|
|||||||||||| ||| | |||| ||||||||||| ||||||||| | |||||||||| ||||| |
|
|
| T |
4413839 |
gcgctcattcctgtttcgaagacaagttccgtgcctattcagttgagatgtgggttcgtgccgcc |
4413775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University