View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9856_low_43 (Length: 221)
Name: NF9856_low_43
Description: NF9856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9856_low_43 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 49257878 - 49258098
Alignment:
| Q |
1 |
actgttccaaatttgaactggtaggctaagaataattttcaggcagggagacagcacacataccagaccctcctcctcccccaccccattaccaatctaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
49257878 |
actgttccaaatttgaactggtaggctaagaataattttcaggcagggagacagcacacataccagacccttctcctcccccaccccatcaccaatctaa |
49257977 |
T |
 |
| Q |
101 |
caaataaagcaaatcaacattgtcaaaattcaagagtgtcatgatttttcgaagttagagatgtgagtgtgagccaactgggactagtgagcaactaaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49257978 |
caaataaagcaaatcaacattgtcaaaattcaagagtgtcatgatttttcgaagttagagatgtgagtgtgagccaactgggactagtgagcaactaaac |
49258077 |
T |
 |
| Q |
201 |
aagtttttctttataaacccg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
49258078 |
aagtttttctttataaacccg |
49258098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University