View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9857_high_18 (Length: 262)
Name: NF9857_high_18
Description: NF9857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9857_high_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 8 - 246
Target Start/End: Original strand, 30854912 - 30855151
Alignment:
| Q |
8 |
aagcagagaaaatgcaataaagaaccaggagagggcttgaaccctatttacacatgttagaacctaagaaacacacatttgtttaatctctttgttgaaa |
107 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
30854912 |
aagcaaaggaaatgcaataaagaaccaggagagggcttgaaccctatttacacatgttagaacctaaaaaacacacatttgtttaatctctttgttgaaa |
30855011 |
T |
|
| Q |
108 |
ttgttgtcatgtgggtaaacaccttcttgcttccctccaaagaaacaccttcgttctttgaggaatcttcaaaccccataaatttttccaattatcaacc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30855012 |
ttgttgtcatgtgggtaaacaccttcttgcttccctccaaagaaacaccttcgttctttgaggaatcttcaaaccccataaatttttccaattgtcaacc |
30855111 |
T |
|
| Q |
208 |
acttgatactcacta-tgtccatcaaatgctccataatat |
246 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
30855112 |
acttgatactcactattatccatcaaatgctccataatat |
30855151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University