View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9857_high_19 (Length: 256)
Name: NF9857_high_19
Description: NF9857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9857_high_19 |
 | |
|
| [»] scaffold0506 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0506 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: scaffold0506
Description:
Target: scaffold0506; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 144 - 245
Target Start/End: Complemental strand, 10932 - 10831
Alignment:
| Q |
144 |
gataccgggttggatggagtgatgaaatattgggctttgattgtggatgctaacagtgggtatcagtgacgtgtttccctgctggaaagcttgcaacacc |
243 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
10932 |
gatacagggttggatggagtgatgaaatattgggctttgattgtggaggccaacagtgggtatcagagacatgtttccctgctggaaagcttgcaacacc |
10833 |
T |
|
| Q |
244 |
aa |
245 |
Q |
| |
|
|| |
|
|
| T |
10832 |
aa |
10831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 82; Significance: 8e-39; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 144 - 245
Target Start/End: Original strand, 19827146 - 19827247
Alignment:
| Q |
144 |
gataccgggttggatggagtgatgaaatattgggctttgattgtggatgctaacagtgggtatcagtgacgtgtttccctgctggaaagcttgcaacacc |
243 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
19827146 |
gatacagggttggatggagtgatgaaatattgggctttgattgtggaggccaacagtgggtatcagagacatgtttccctgctggaaagcttgcaacacc |
19827245 |
T |
|
| Q |
244 |
aa |
245 |
Q |
| |
|
|| |
|
|
| T |
19827246 |
aa |
19827247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 90
Target Start/End: Original strand, 19920741 - 19920836
Alignment:
| Q |
1 |
cttttaaaggcaaagacgtgtataatccaat-----ttcattgcttttccc-atttctagacacacatcaattttatgtgggatcaaagctgagaa |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
19920741 |
cttttaaaggcaaagacgtgtataatccaatccactttcattgcttttccccatttctagacacacatcaattttatgtgcgatcaaagctgagaa |
19920836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 42 - 83
Target Start/End: Complemental strand, 14932812 - 14932773
Alignment:
| Q |
42 |
ttcccatttctagacacacatcaattttatgtgggatcaaag |
83 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
14932812 |
ttcccatttcta--cacacatcaattttatgtgggatcaaag |
14932773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University