View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9857_high_19 (Length: 256)

Name: NF9857_high_19
Description: NF9857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9857_high_19
NF9857_high_19
[»] scaffold0506 (1 HSPs)
scaffold0506 (144-245)||(10831-10932)
[»] chr1 (3 HSPs)
chr1 (144-245)||(19827146-19827247)
chr1 (1-90)||(19920741-19920836)
chr1 (42-83)||(14932773-14932812)


Alignment Details
Target: scaffold0506 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: scaffold0506
Description:

Target: scaffold0506; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 144 - 245
Target Start/End: Complemental strand, 10932 - 10831
Alignment:
144 gataccgggttggatggagtgatgaaatattgggctttgattgtggatgctaacagtgggtatcagtgacgtgtttccctgctggaaagcttgcaacacc 243  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| ||| |||||||||||||||||||||||||||||    
10932 gatacagggttggatggagtgatgaaatattgggctttgattgtggaggccaacagtgggtatcagagacatgtttccctgctggaaagcttgcaacacc 10833  T
244 aa 245  Q
    ||    
10832 aa 10831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 82; Significance: 8e-39; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 144 - 245
Target Start/End: Original strand, 19827146 - 19827247
Alignment:
144 gataccgggttggatggagtgatgaaatattgggctttgattgtggatgctaacagtgggtatcagtgacgtgtttccctgctggaaagcttgcaacacc 243  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| ||| |||||||||||||||||||||||||||||    
19827146 gatacagggttggatggagtgatgaaatattgggctttgattgtggaggccaacagtgggtatcagagacatgtttccctgctggaaagcttgcaacacc 19827245  T
244 aa 245  Q
    ||    
19827246 aa 19827247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 90
Target Start/End: Original strand, 19920741 - 19920836
Alignment:
1 cttttaaaggcaaagacgtgtataatccaat-----ttcattgcttttccc-atttctagacacacatcaattttatgtgggatcaaagctgagaa 90  Q
    |||||||||||||||||||||||||||||||     ||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||    
19920741 cttttaaaggcaaagacgtgtataatccaatccactttcattgcttttccccatttctagacacacatcaattttatgtgcgatcaaagctgagaa 19920836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 42 - 83
Target Start/End: Complemental strand, 14932812 - 14932773
Alignment:
42 ttcccatttctagacacacatcaattttatgtgggatcaaag 83  Q
    ||||||||||||  ||||||||||||||||||||||||||||    
14932812 ttcccatttcta--cacacatcaattttatgtgggatcaaag 14932773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University