View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9857_high_25 (Length: 239)

Name: NF9857_high_25
Description: NF9857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9857_high_25
NF9857_high_25
[»] chr6 (1 HSPs)
chr6 (1-223)||(27163178-27163400)


Alignment Details
Target: chr6 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 27163400 - 27163178
Alignment:
1 tgttatgcaaacattcaaaaattggaattatgttcactcagacaaactaacccatactatggtgaatgaaaccacaataaaagagtgaaggcatagaata 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27163400 tgttatgcaaacattcaaaaattggaattatgttcactcagacaaactaacccatactatggtgaatgaaaccacaataaaagagtgaaggcatagaata 27163301  T
101 acttctctcttaagatacgtctagtaatttggaaaatgcagggaatcacaatggaccaacgaaaatgatcaccgtatgctgcaatttctacacagaaaat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
27163300 acttctctcttaagatacgtctagtaatttggaaaatgcagggaatcacaatggaccaacgaaaatgatcaccgtatgctgcaatttctacacggaaaat 27163201  T
201 acgaggaaattttgtgaacaaat 223  Q
    |||||||||||||||||||||||    
27163200 acgaggaaattttgtgaacaaat 27163178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University