View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9857_high_26 (Length: 237)
Name: NF9857_high_26
Description: NF9857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9857_high_26 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 15 - 237
Target Start/End: Complemental strand, 48697773 - 48697551
Alignment:
| Q |
15 |
gtttcatcatggattgtgtcaccatgatgttaatcttgttatcttcaacaagaaggatcttaggctttgatatggatttggttacttctgatttactatt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48697773 |
gtttcatcatggattgtgtcaccatgatgttaatcttgttatcttcaacaagaaggatcttaggctttgatatggatttggttacttctgatttactatt |
48697674 |
T |
 |
| Q |
115 |
gctagaagcacattgagtagttgagtttaccaccatgtgctgagaagaatctgcaataccattctggaaccatgcatgagcattatatagatgatgtttg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48697673 |
gctagaagcacattgagtagttgagtttaccaccatgtgctgagaagaatctgcaataccattctggaaccatgcatgagcattatatagatgatgtttg |
48697574 |
T |
 |
| Q |
215 |
tggctagatgaactagcagattc |
237 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
48697573 |
tggctagatgaactagcagattc |
48697551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 15 - 69
Target Start/End: Complemental strand, 48709078 - 48709024
Alignment:
| Q |
15 |
gtttcatcatggattgtgtcaccatgatgttaatcttgttatcttcaacaagaag |
69 |
Q |
| |
|
||||||||||||||||||| | |||||| |||||||| | ||||||||||||||| |
|
|
| T |
48709078 |
gtttcatcatggattgtgttatcatgatattaatcttctcatcttcaacaagaag |
48709024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 17 - 106
Target Start/End: Original strand, 3452984 - 3453073
Alignment:
| Q |
17 |
ttcatcatggattgtgtcaccatgatgttaatcttgttatcttcaacaagaaggatcttaggctttgatatggatttggttacttctgat |
106 |
Q |
| |
|
|||||||| || | |||||||||||| |||||||||||||||||||||||||| || || |||||| | | |||||||||||||||||| |
|
|
| T |
3452984 |
ttcatcattgactttgtcaccatgatattaatcttgttatcttcaacaagaagaatattcggctttaacgtcgatttggttacttctgat |
3453073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University