View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9857_high_27 (Length: 237)

Name: NF9857_high_27
Description: NF9857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9857_high_27
NF9857_high_27
[»] chr3 (2 HSPs)
chr3 (49-224)||(46928641-46928816)
chr3 (1-52)||(46928845-46928896)


Alignment Details
Target: chr3 (Bit Score: 176; Significance: 6e-95; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 49 - 224
Target Start/End: Complemental strand, 46928816 - 46928641
Alignment:
49 gagacgagatcatttcctttaccattggaattggtaataccgtgatggaacaattattccaatattatcttatgactaaccactaattagcaaattatta 148  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46928816 gagacgagatcatttcctttaccattggaattggtaataccgtgatggaacaattattccaatattatcttatgactaaccactaattagcaaattatta 46928717  T
149 gtagaaaacatacataaccgttgaggaagggtttgactgattactactaatagaaatggaaatggaatggaataaa 224  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46928716 gtagaaaacatacataaccgttgaggaagggtttgactgattactactaatagaaatggaaatggaatggaataaa 46928641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 46928896 - 46928845
Alignment:
1 tagttctactactagtagtgtatataacctttttgtttctcaaaaaatgaga 52  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
46928896 tagttctactactagtagtgtatataacctttttgtttctcaaaaaatgaga 46928845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University