View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9857_high_6 (Length: 387)
Name: NF9857_high_6
Description: NF9857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9857_high_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 23 - 291
Target Start/End: Complemental strand, 1441554 - 1441286
Alignment:
| Q |
23 |
aaatcttagcattgaatgttacatttccggttgctctaagttttgggcttgtaaacttgtcaacaaagctgaaaagtaattattcttattatagcaacag |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1441554 |
aaatcttagcattgaatgttacatttccggttgctctaagttttgggcttgtgaacttgtcaacaaaggtgaaaagtaattattcttattatagcaacag |
1441455 |
T |
 |
| Q |
123 |
agtttcctaatgatcaatttttatgatctgggttttatttttgtgatggtttgatgatagtttttaatgtgccactgattattgtggaagtaactcagtc |
222 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
1441454 |
agtttcctaatgatcaattttcatgatgtgggttttatttttgtgatggtttgatgatagtttttaatgtgccactgattattgtggaagtaactcggtc |
1441355 |
T |
 |
| Q |
223 |
cctattttcctaatttatatttatcttgcttatgaagcgcaaggactcatcacataataacatgaaata |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1441354 |
cctattttcctaatttatatttatcttgcttatgaagcgcaaggactcatcacataataacatgaaata |
1441286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University