View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9857_low_14 (Length: 442)
Name: NF9857_low_14
Description: NF9857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9857_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 400; Significance: 0; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 400; E-Value: 0
Query Start/End: Original strand, 19 - 440
Target Start/End: Complemental strand, 24690798 - 24690380
Alignment:
| Q |
19 |
gaccatccctcccctccaaagttttatgaccttgacattttcttaggtagcgagctcacttggttcaaggtgatgcaccatgtaaaggttgcaccaaggc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24690798 |
gaccatccctcccctccaaagttttatgaccttgacattttcttaggtagcgagctcacttggttcaaggtgatgcaccatgtaaaggttgcaccaaggc |
24690699 |
T |
|
| Q |
119 |
aaagtcaaactgatggtccttgctctgaagtgtgaatcagtggtatggaccagttcttaagatcaactcttcgcaatgtgagtgcagtaatcatcagacc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24690698 |
aaagtcaaactgatggtccttgctctgaagtgtgaatcagtggtatggaccagttcttaagatcaactcttcgcaatgtgagtgcagtaatcatcagacc |
24690599 |
T |
|
| Q |
219 |
atcactgcgcaggcctagatgaccagtatgaatattatgaggttcagtatgcagatcatggatcttcagttcactaacaaagttacactgaaatattatt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24690598 |
atcactgcgcaggcctagatgaccagtatgaatattatgaggttcagtatgcagatcatggatcttcagttcactaacaaagttacactgaaatattatt |
24690499 |
T |
|
| Q |
319 |
tgttttgatgactctcgaagtccacatgatgctattgttgtttcatttcagttttttaagtcttggtaaatacaacaataatgatgaggctgcaatgtgc |
418 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24690498 |
tgttttgatgactctcgaagtccacatgatgctattgttgtttcatttcagttttttaagtcttggtaaat---acaataatgatgaggctgcaatgtgc |
24690402 |
T |
|
| Q |
419 |
attcagctggttctgtgctgct |
440 |
Q |
| |
|
|||||||||||| |||| |||| |
|
|
| T |
24690401 |
attcagctggttttgtggtgct |
24690380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 348 - 428
Target Start/End: Complemental strand, 24717826 - 24717745
Alignment:
| Q |
348 |
tgctattgttgtttcatttcagttttttaagtcttggtaaatacaaca-ataatgatgaggctgcaatgtgcattcagctgg |
428 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| | |||||| || || ||||||| ||||| |||||| |||||||| |
|
|
| T |
24717826 |
tgctattgttgttttgtttcagttttttaagtcttgttgaatacatcagctattgatgagactgcagtgtgcactcagctgg |
24717745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 340 - 374
Target Start/End: Complemental strand, 24630879 - 24630845
Alignment:
| Q |
340 |
ccacatgatgctattgttgtttcatttcagttttt |
374 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |
|
|
| T |
24630879 |
ccacataatgctattgttgtttcatttcagttttt |
24630845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 31 - 127
Target Start/End: Complemental strand, 10330785 - 10330688
Alignment:
| Q |
31 |
cctccaaagttttatgaccttgacattttcttaggtagcgagctcacttgg-ttcaaggtgatgcaccatgtaaaggttgcaccaaggcaaagtcaaa |
127 |
Q |
| |
|
||||||||| ||||||||||||| || || |||||| || ||||||||| |||| ||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
10330785 |
cctccaaagctttatgaccttgatatcgactcaggtagtgacctcacttgggttcagtgtgatgcaccatgtaaaggttgcactaaggtaaagtcaaa |
10330688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University