View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9857_low_18 (Length: 405)
Name: NF9857_low_18
Description: NF9857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9857_low_18 |
 |  |
|
| [»] scaffold0734 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0734 (Bit Score: 362; Significance: 0; HSPs: 1)
Name: scaffold0734
Description:
Target: scaffold0734; HSP #1
Raw Score: 362; E-Value: 0
Query Start/End: Original strand, 1 - 382
Target Start/End: Original strand, 604 - 985
Alignment:
| Q |
1 |
tgctacttgtgactgccagctttttcaatttatgggattgctatgtaggcatatcttggtgatttttcatgcaaaaaatgttgcagaaattccagacatg |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
604 |
tgctacttgtgactgtcagctttttcaattgatgggattgctatgtaggcatatcttggtgatttttcatgcaaaaaatgttgcagaaattccagacatg |
703 |
T |
 |
| Q |
101 |
tatattttaaagcgttggacaaaggatgctaacaaaggtgctgtgtttattgaagatggaccagagtcttcctctacaggaaactcatcaactttgcgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| || |
|
|
| T |
704 |
tatattttaaagcgttggacaaaggatgctaacaaaggtgttgtgtttattgaagatggaccaaagtcttcctctacaggaaactcatcaactttgcaaa |
803 |
T |
 |
| Q |
201 |
gtttacatgtacacaaacaagcaagtttgttacctgatcttgcagcaaaatctgagaaaatatataagctgatatcatctgatttggaggaaacatacaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
804 |
gtttacatgtacacaaacaagcaagtttgttacctgatcttgcagcaaaatctgagaaaatatataagctgatatcatctgatttggaggaaacatacaa |
903 |
T |
 |
| Q |
301 |
aaaagctttgataatggaagctgaattagacaatgagagcgacataattcctccagatgcaagttgtcaaaatctgatacat |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
904 |
aaaagctttgataatggaagctgaattagacaatgagagcgacataattcctccagatgcaagttgtcaaaatctgatacat |
985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University