View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9857_low_28 (Length: 333)
Name: NF9857_low_28
Description: NF9857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9857_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 150 - 317
Target Start/End: Complemental strand, 44407476 - 44407309
Alignment:
| Q |
150 |
cttagtgatggatttgtggaactctgtgtttgactttgatctcctccttcacggtgtggtatgttaatgtagcacacaactccttcaagatttataactt |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |||||||||||||| |||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
44407476 |
cttagtgatggatttgtggaactctgtgtttgattttggtctcctccttcacgatgtggtatgtcaatgtagcacacaactccttcaagatttgtaactt |
44407377 |
T |
 |
| Q |
250 |
ctttcatccaccaatgcggttgatgttgctacaaccatgaaatttgagtttcttgcatcattgcatgt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44407376 |
ctttcatccaccaatgcggttgatgttgctacaaccatgaaatttgagtttcttgcatcattgcatgt |
44407309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University