View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9857_low_32 (Length: 323)
Name: NF9857_low_32
Description: NF9857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9857_low_32 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 4 - 316
Target Start/End: Original strand, 48451107 - 48451428
Alignment:
| Q |
4 |
tttagaaactcctgatttagcttcatcattgtagcaactagcaagtattaccaacatttgttatagtttgtcttggatgtgttacatgtgtgcttccc-- |
101 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48451107 |
tttagaaactcctgatattgcttcatcattgtagcaactagcaagtattaccaacatttgttatagtttgtcttggatgtgttacatgtgtgcttccccc |
48451206 |
T |
|
| Q |
102 |
------agatggtggattcttctgccgagaatctgttgagaaactcatattttattaattaaaattgaatagttcttttgttctttgaatttctcttata |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48451207 |
ccccccagatggtggattcttctgccgagaatctgttgagaaactcatattttattaattaaaattgaatagttcttttgttctttgaatttctcttata |
48451306 |
T |
|
| Q |
196 |
tagtatgtgtttgatattctgcacttaacttatgtctcactacttgtttttgtactgactgtatttcaaacacagtttgcaaaaactcagtttatgtgt- |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48451307 |
tagtatgtgtttgatattctgcacttaacttatgtctcactacttgtttttgtactgactgtatttcaaacacagtttgcaaaaactcagtttatgtgtc |
48451406 |
T |
|
| Q |
295 |
ttgcttttccttttatcctttg |
316 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
48451407 |
ttgcttttccttttatcctttg |
48451428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University