View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9857_low_38 (Length: 293)
Name: NF9857_low_38
Description: NF9857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9857_low_38 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 135; Significance: 2e-70; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 138 - 276
Target Start/End: Original strand, 24947243 - 24947381
Alignment:
| Q |
138 |
cccggcgaaaattctttccacggatgctgacgctgtcatgggtcggagccctttgcaagagaaatgaatcaagtgccagttgcatatttatcaatgattt |
237 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24947243 |
cccggcgaaaattctttccacggatgccgacgctgtcatgggtcggagccctttgcaagagaaatgaatcaagtgccagttgcatatttatcaatgattt |
24947342 |
T |
|
| Q |
238 |
agtaaaggtagctggtatataatttgaaaggaagatagt |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24947343 |
agtaaaggtagctggtatataatttgaaaggaagatagt |
24947381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 24947060 - 24947193
Alignment:
| Q |
1 |
ttctgttatttctactaatattagagagatatgagctgttgtagaagaatgtaaaatgtggttgaattggtatgagaatgattttttcggtacagagata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24947060 |
ttctgttatttctactaatattagagagatatgagctgttgtagaagaatgtaaaatgcggttgaattggtatgagaatgattttttcggtgcagagata |
24947159 |
T |
|
| Q |
101 |
aaatggttcaaaaaattatcaacgagggaacgcg |
134 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
24947160 |
aaatggttcaaaaaattataaacgagggaacgcg |
24947193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 222 - 267
Target Start/End: Original strand, 24954070 - 24954115
Alignment:
| Q |
222 |
tatttatcaatgatttagtaaaggtagctggtatataatttgaaag |
267 |
Q |
| |
|
||||||||||||||| || |||||||||||| ||| |||||||||| |
|
|
| T |
24954070 |
tatttatcaatgattcagaaaaggtagctggaatacaatttgaaag |
24954115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University