View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9857_low_41 (Length: 280)
Name: NF9857_low_41
Description: NF9857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9857_low_41 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 239; Significance: 1e-132; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 16 - 270
Target Start/End: Complemental strand, 42699696 - 42699442
Alignment:
| Q |
16 |
catgatttgcaaacacatttaaattgaaggagggatctcacaggaagtcttgcaaggatctcgtcgatgagttctttcggcaattctggcaatagcaata |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42699696 |
catgatttgcaaacacatttaaattgaaggagggatctcacaggaagtcttgcaagaatctcgtcgatgagttctttcggcaattctggcaatagcaata |
42699597 |
T |
 |
| Q |
116 |
tattctcggcattagtttcaggaactggtagagttgaaacagtgtcgttctgagagtggtagagagtgagcttgcgtttcacgatcttaaagtcatcacc |
215 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42699596 |
tattctcggcattagtttcaggaaccggtagagttgaaacagtatcgttctgagagtggtagagagtgagcttgcgtttcacgatcttaaagtcatcacc |
42699497 |
T |
 |
| Q |
216 |
catctttgttacagctgctgtttcttattttgcagcagaactggaaaaccctttg |
270 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42699496 |
catctttgtcacagctgctgtttcttattttgcagcagaactggaaaaccctttg |
42699442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 31 - 65
Target Start/End: Original strand, 24042513 - 24042547
Alignment:
| Q |
31 |
catttaaattgaaggagggatctcacaggaagtct |
65 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |
|
|
| T |
24042513 |
catttaaattgaaggagggatctcaccggaagtct |
24042547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 16 - 65
Target Start/End: Complemental strand, 42693690 - 42693641
Alignment:
| Q |
16 |
catgatttgcaaacacatttaaattgaaggagggatctcacaggaagtct |
65 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| |||| ||| |||||||| |
|
|
| T |
42693690 |
catgatttgcagacacatttgaattgaaggagagatcgcactggaagtct |
42693641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 31 - 65
Target Start/End: Complemental strand, 24001618 - 24001584
Alignment:
| Q |
31 |
catttaaattgaaggagggatctcacaggaagtct |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
24001618 |
catttaaattgaaggagggatctcacaggaagtct |
24001584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 16 - 97
Target Start/End: Original strand, 43986924 - 43987005
Alignment:
| Q |
16 |
catgatttgcaaacacatttaaattgaaggagggatctcacaggaagtcttgcaaggatctcgtcgatgagttctttcggca |
97 |
Q |
| |
|
||||||||||||| ||||| |||||||| |||||| |||| |||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
43986924 |
catgatttgcaaatgcatttgaattgaagcagggatttcaccggaagtctcaaaaggatctcaatgatgagttctttcggca |
43987005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University