View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9857_low_45 (Length: 256)
Name: NF9857_low_45
Description: NF9857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9857_low_45 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 203 - 256
Target Start/End: Original strand, 11627487 - 11627540
Alignment:
| Q |
203 |
gtcactgagggtatttagactaatctagagatcatggcagaggctgtgaatttt |
256 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
11627487 |
gtcactgagggtattttgactgatctagagatcatggcagaggctgtgaatttt |
11627540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 152 - 188
Target Start/End: Original strand, 11627304 - 11627340
Alignment:
| Q |
152 |
aaaatctggttagcatatcaaactttgtcgctattag |
188 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
11627304 |
aaaatctggttagcatatcaaagtttgtctctattag |
11627340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University