View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9857_low_47 (Length: 251)
Name: NF9857_low_47
Description: NF9857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9857_low_47 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 2 - 119
Target Start/End: Original strand, 27163423 - 27163540
Alignment:
| Q |
2 |
atgttcccatacaagttagagtcgagggatgcagtttccttggagtacggttttgtttttaatttggttcgagtgtaccaagtaccaaggtatacttttg |
101 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
27163423 |
atgttcccatacaagttagggtcgagggatgcagtttccttggagtacggttttgtttttaatttggtttgagtgtaccaagtaccatggtatacttttg |
27163522 |
T |
 |
| Q |
102 |
ctattgtgttattgcatt |
119 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
27163523 |
ctattgtgttattgcatt |
27163540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 168 - 239
Target Start/End: Original strand, 27163645 - 27163716
Alignment:
| Q |
168 |
gttgtgaaccctaccttgtctacaatagtcctcttgttgtgtgcttacaatttcagagttttgtcaagccta |
239 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
27163645 |
gttgtcaaccctaccttgtctacaatagtcctcttgttgtgtgcttgcaatttcagagttttgtcaatccta |
27163716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University