View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9857_low_50 (Length: 250)
Name: NF9857_low_50
Description: NF9857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9857_low_50 |
 | |
|
| [»] scaffold0041 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0041 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 36884 - 37117
Alignment:
| Q |
1 |
aaaaatggtctttatcctaggaataacagtttgcaaaaataaatggaaaggcaatgtaaaaccaaaa------cccaaaccaatctttgattgactcatt |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36884 |
aaaaatggtctttatcctaggaataacagtttgcaaaaataaatggaaaggcaatgtaaaaccaaaatcagaacccaaaccaatctttgattgactcatt |
36983 |
T |
|
| Q |
95 |
ccttaaggatttaatttcttgtaacttttcaagtcttcgatctctggcagaactcttactattcatcatatttgactcgactgttgttgaacaaaatttc |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |||||||||||||||||||| ||| |
|
|
| T |
36984 |
ccttaaggatttaatttcttgtaacttttcaagtcttcgatctctggcaggactctcactattcatcatatttgattcgactgttgttgaacaaaacttc |
37083 |
T |
|
| Q |
195 |
aagaaccaatatgctttccaaggcatgcatgcac |
228 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
37084 |
aagagccaatatgctttccaaggcatgcatgcac |
37117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University