View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9857_low_59 (Length: 237)
Name: NF9857_low_59
Description: NF9857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9857_low_59 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 6e-95; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 49 - 224
Target Start/End: Complemental strand, 46928816 - 46928641
Alignment:
| Q |
49 |
gagacgagatcatttcctttaccattggaattggtaataccgtgatggaacaattattccaatattatcttatgactaaccactaattagcaaattatta |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46928816 |
gagacgagatcatttcctttaccattggaattggtaataccgtgatggaacaattattccaatattatcttatgactaaccactaattagcaaattatta |
46928717 |
T |
 |
| Q |
149 |
gtagaaaacatacataaccgttgaggaagggtttgactgattactactaatagaaatggaaatggaatggaataaa |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46928716 |
gtagaaaacatacataaccgttgaggaagggtttgactgattactactaatagaaatggaaatggaatggaataaa |
46928641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 46928896 - 46928845
Alignment:
| Q |
1 |
tagttctactactagtagtgtatataacctttttgtttctcaaaaaatgaga |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46928896 |
tagttctactactagtagtgtatataacctttttgtttctcaaaaaatgaga |
46928845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University