View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9857_low_62 (Length: 230)
Name: NF9857_low_62
Description: NF9857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9857_low_62 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 119; Significance: 6e-61; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 104 - 230
Target Start/End: Complemental strand, 41919952 - 41919826
Alignment:
| Q |
104 |
gaaccttatgattcggttccttttttaaaacatctttaattatgaatattttaaaaatccaagattgaattattgagtttgaaataattatgaaagtgga |
203 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41919952 |
gaaccatatgattcggttcgttttttaaaacatctttaattatgaatattttaaaaatccaagattgaattattgagtttgaaataattatgaaagtgga |
41919853 |
T |
|
| Q |
204 |
ccttcaagtttgacaagtataagaact |
230 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
41919852 |
ccttcaagtttgacaagtataagaact |
41919826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 1 - 111
Target Start/End: Complemental strand, 41920092 - 41919982
Alignment:
| Q |
1 |
tttcttttcaaatcaatactttaacaacaaaacctgaatcatggttcaactgttttaaaccgcttaaacatgataaagattcaattgaaacatttaaata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41920092 |
tttcttttcaaatcaatactttaacaacaaaacctgaatcatggttcaactgttttaaaccgcttaaacatgataaagattcaattgaaccatttaaata |
41919993 |
T |
|
| Q |
101 |
accgaacctta |
111 |
Q |
| |
|
||||||||||| |
|
|
| T |
41919992 |
accgaacctta |
41919982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University