View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9857_low_66 (Length: 223)
Name: NF9857_low_66
Description: NF9857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9857_low_66 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 51705981 - 51706192
Alignment:
| Q |
1 |
cttggtacgtatcaagcagttacatatctatagttnnnnnnnnn-ttgatattatatgaatgatatg-gtgtgtctttttgtgtttagagaactactata |
98 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
51705981 |
cttggtacgtatcaagcagttatatatctatagttcaaaaaaaagttgatattatatgaatgatatgagtgtgtctgtttgtgtttagagaactactata |
51706080 |
T |
 |
| Q |
99 |
gaatcggttgcaaaggg-tttgaatgtcatcacagcacaaggtagggaaagaatgtcagacgacaccggattcacttttgttcattgcaacataactgga |
197 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
51706081 |
gaatcggttgcaaaggggtttgaatgtcatcacagcacaaggtagggaaagaatgtcggacgacactggattcacttttgttcattgcaacataactgga |
51706180 |
T |
 |
| Q |
198 |
agtggtcacagg |
209 |
Q |
| |
|
|||||||||||| |
|
|
| T |
51706181 |
agtggtcacagg |
51706192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University