View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9857_low_68 (Length: 220)
Name: NF9857_low_68
Description: NF9857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9857_low_68 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 44701342 - 44701567
Alignment:
| Q |
1 |
gaatcaaagaaatgattggtag------aagataatgcatttcattgaaatcgacatatatgcttaaggtttcaagcatacaaattagacgacaatccat |
94 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44701342 |
gaatcaaagaaatgattggtagaagtagaagataatgcatttcattgaaatcgacatatatgcttaaggtttcaagcatacaaattagacgacaatccat |
44701441 |
T |
 |
| Q |
95 |
taacatgtgaaaatcaattggttagggaatcgaatccattgtttaattagacctcctctactgccataatgccacaaatcaatgttgcccaatgatgttt |
194 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44701442 |
taacatgtgaaaatcaattgcttagggaatcgaatccattgtttaattagacctcctctactgccataatgccacaaatcaatgttgcccaatgatgttt |
44701541 |
T |
 |
| Q |
195 |
tggaatggcttattttcactgcattt |
220 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
44701542 |
tggaatggcttattttcactgcattt |
44701567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University