View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9857_low_70 (Length: 215)
Name: NF9857_low_70
Description: NF9857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9857_low_70 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 87 - 195
Target Start/End: Original strand, 28997468 - 28997576
Alignment:
| Q |
87 |
tctataatataattagtttccaaaattacggtgtgaaatagtgattatgtgaaattcaccaccaacccgaataacaccaaatgaaatttagttaccttca |
186 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
28997468 |
tctataatataattattttccaaaattacggtgtgaaatagtgattatgtgaaattcaccaccaacccgaataacaccaagtgaaatttagttaccttca |
28997567 |
T |
|
| Q |
187 |
catgtcact |
195 |
Q |
| |
|
||||||||| |
|
|
| T |
28997568 |
catgtcact |
28997576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University