View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9858_high_11 (Length: 293)
Name: NF9858_high_11
Description: NF9858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9858_high_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 11 - 268
Target Start/End: Complemental strand, 4702292 - 4702035
Alignment:
| Q |
11 |
cagagagcaaaacaggattaggccgcaaaatctctttgccagtctagtgccctgtagggcaatagagcaaaacagcctaaacnnnnnnngaagtgtttag |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4702292 |
cagagagcaaaacaggattaggccgcaaaatctctggtctagtctagtgccctgtagggcaatagagcaaaacagcctaaactttttttgaagtgtttag |
4702193 |
T |
|
| Q |
111 |
gggaaaacttacaagggagttaatgcaatttccccttaaattaaacatggagtggattcaaaaaatgaagtcaatcacatgagcaacaacaggtacaagg |
210 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4702192 |
gggaaaacttacaggggagttaatgcaatttccccttaaattaaacatggagtggattcaaaaaatgaagtcaatcacatgagcaacaacaggtacaagg |
4702093 |
T |
|
| Q |
211 |
aaacaatgaaaagtcagaaagttatcgagaaaagactattatttcaatacaaacttgc |
268 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
4702092 |
aaacaatgaaaagtaagaaagttaccgagaaaagactattatctcaatacaaacttgc |
4702035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University