View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9858_high_14 (Length: 258)
Name: NF9858_high_14
Description: NF9858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9858_high_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 23 - 250
Target Start/End: Complemental strand, 1529058 - 1528839
Alignment:
| Q |
23 |
tgatctgtcttttgaagcttgaaccagccggtgagcacactggttcaatggttgannnnnnnnnnnnattaccttacttctagtcttgcatacatagtaa |
122 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||| |||||||||| |||||||| |||||||||||||||||||| ||| |
|
|
| T |
1529058 |
tgatccgtcttttgaagcttgaaccag----tgagcacactggtgcaatggttgatttgattttt--attaccttgcttctagtcttgcatacataataa |
1528965 |
T |
|
| Q |
123 |
gatccatacgccaaggtaatattgcgacaaaggaaaaccaggaaaaatatccagtaactgctcataagttttatccaaaaacaaataacataaatttggt |
222 |
Q |
| |
|
||||||||| |||||||||||||| || || ||||| | |||||||||||| | |||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1528964 |
gatccatactccaaggtaatattgtgaaaatggaaatc-aggaaaaatatcta-taactgttcataagttttatccaaaaacaaataacataaatttggt |
1528867 |
T |
|
| Q |
223 |
ttttgaaagttaatatatgccctatgct |
250 |
Q |
| |
|
||||||||||||||||||| || ||||| |
|
|
| T |
1528866 |
ttttgaaagttaatatatgacccatgct |
1528839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University