View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9858_high_14 (Length: 258)

Name: NF9858_high_14
Description: NF9858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9858_high_14
NF9858_high_14
[»] chr4 (1 HSPs)
chr4 (23-250)||(1528839-1529058)


Alignment Details
Target: chr4 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 23 - 250
Target Start/End: Complemental strand, 1529058 - 1528839
Alignment:
23 tgatctgtcttttgaagcttgaaccagccggtgagcacactggttcaatggttgannnnnnnnnnnnattaccttacttctagtcttgcatacatagtaa 122  Q
    ||||| |||||||||||||||||||||    ||||||||||||| ||||||||||            |||||||| |||||||||||||||||||| |||    
1529058 tgatccgtcttttgaagcttgaaccag----tgagcacactggtgcaatggttgatttgattttt--attaccttgcttctagtcttgcatacataataa 1528965  T
123 gatccatacgccaaggtaatattgcgacaaaggaaaaccaggaaaaatatccagtaactgctcataagttttatccaaaaacaaataacataaatttggt 222  Q
    ||||||||| |||||||||||||| || || ||||| | |||||||||||| | |||||| |||||||||||||||||||||||||||||||||||||||    
1528964 gatccatactccaaggtaatattgtgaaaatggaaatc-aggaaaaatatcta-taactgttcataagttttatccaaaaacaaataacataaatttggt 1528867  T
223 ttttgaaagttaatatatgccctatgct 250  Q
    ||||||||||||||||||| || |||||    
1528866 ttttgaaagttaatatatgacccatgct 1528839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University