View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9858_high_16 (Length: 249)
Name: NF9858_high_16
Description: NF9858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9858_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 5 - 244
Target Start/End: Complemental strand, 21227992 - 21227753
Alignment:
| Q |
5 |
caacaaaatgccgtagccggaagaaaacacaaacacatcttaaatgtgactcgatgtctaatgtttcaaagtaaaagtccattccaaacacaaacacaaa |
104 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21227992 |
caacaaaatgccgtagccggaagaaaacataaacacatcttaaatgtgactcgatgtctaatgtttcaaagtaaaagtccattccaaacacaaacacaaa |
21227893 |
T |
 |
| Q |
105 |
caattgcggtcttatgctgccagtcatgccatatatattatcaacaggctccattcccttgtccttcaaaataaaagtactttccaaatgacttactttt |
204 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
21227892 |
caattttggtcttatgctgccagtcatgccatatatattatcaacaggctccattcccttgtccttcaaaataaaagtactttccaaatgccttactttt |
21227793 |
T |
 |
| Q |
205 |
ggatcatttgaaagtttttcggcatcttgcctttgcttct |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
21227792 |
ggatcatttgaaagtttttcggcatcttgcttttgcttct |
21227753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University