View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9858_high_24 (Length: 230)
Name: NF9858_high_24
Description: NF9858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9858_high_24 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 54608290 - 54608053
Alignment:
| Q |
1 |
agttcttgcaggatcatcctaatataataaataaataaat--------tgtagttttcagtagccagtataaagtttggggcatggagaagtctcttgtt |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54608290 |
agttcttgcaggatcatcctaatataataaataaataaataaataaactgtagttttcagtagccagtataaagtttggggcatggagaagtctcttgtt |
54608191 |
T |
 |
| Q |
93 |
aattgccatccatatatctcccttggaccttggtccacttgcaagttgcaaatgatcggtacccagattcatacctagccttctctcttcttaaatacca |
192 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54608190 |
aattgctatccatatatctcccttggaccttggtccacttgcaagttgcaaatgatcggtacccagattcatacctagccttctctcttcttaaatacca |
54608091 |
T |
 |
| Q |
193 |
ataccaatctagcgcagcacattttgcaccaaattcac |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54608090 |
ataccaatctagcgcagcacattttgcaccaaattcac |
54608053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University