View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9858_low_22 (Length: 294)
Name: NF9858_low_22
Description: NF9858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9858_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 245; Significance: 1e-136; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 18 - 277
Target Start/End: Original strand, 33499117 - 33499377
Alignment:
| Q |
18 |
gattttgcaggcaaaacaagcttcacttggcgcaaactcgatggaggaaacttacaagcaagcagctttagaaattatgacgaggatcgcttaaaatttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33499117 |
gattttgcaggcaaaacaagcttcacttggcgcaaactcgatggaggaaacttacaagcaagcagctttagaaattatgacgaggatcgcttaaaatttt |
33499216 |
T |
|
| Q |
118 |
gatcataaaacttgtcttttcattccgtatgaattttattttcc-tcctatcggaaacagttagaattggccatctttgatggtcctatgagacatttta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33499217 |
gatcataaaacttgtcttttcattccgtatgaattttattttccttccgatcggaaacagttagaattggccatctttgatggtcctatgagacatttta |
33499316 |
T |
|
| Q |
217 |
tggtgtttaaactagttaaattatttgctttttgtgtttgcttttccaatattgtaaactg |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33499317 |
tggtgtttaaactagttaaattatttgctttttgtgtttgcttttctaatattgtaaactg |
33499377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 19 - 130
Target Start/End: Original strand, 33486101 - 33486212
Alignment:
| Q |
19 |
attttgcaggcaaaacaagcttcacttggcgcaaactcgatggaggaaacttacaagcaagcagctttagaaattatgacgaggatcgcttaaaattttg |
118 |
Q |
| |
|
||||||||||||||||||||||||| || |||||| || ||| ||||||| |||||||| || ||| ||||||||||| | |||||||||| ||||||| |
|
|
| T |
33486101 |
attttgcaggcaaaacaagcttcacatgacgcaaattcaatgaaggaaacatacaagcatgcggctggagaaattatgatgtggatcgcttagaattttg |
33486200 |
T |
|
| Q |
119 |
atcataaaactt |
130 |
Q |
| |
|
|||||||||||| |
|
|
| T |
33486201 |
atcataaaactt |
33486212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 191 - 263
Target Start/End: Original strand, 33486210 - 33486284
Alignment:
| Q |
191 |
ctttgatggtcctatgagacatttt-atggtgtttaaactagtta-aattatttgctttttgtgtttgcttttcc |
263 |
Q |
| |
|
|||||||||||||| ||| ||||| |||||||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
33486210 |
ctttgatggtcctaagagcaatttttatggtgtttaaactagttttaattatatgctttttgtgtttgcttttcc |
33486284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University