View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9858_low_26 (Length: 268)
Name: NF9858_low_26
Description: NF9858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9858_low_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 7 - 184
Target Start/End: Original strand, 46502010 - 46502188
Alignment:
| Q |
7 |
ataggcttagtaacaaatatgagtctcaagagagagcaatgtaaattttatctatgagaaagagtagttagagcattagataaaggatatgtatgcatcc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46502010 |
ataggcttagtaacaaatatgagtctcaagagagagcaatgtaaattttatctatgagaaagagtagttagagcattagataaaggatatgtatgcatcc |
46502109 |
T |
|
| Q |
107 |
ttatattgtacttaatcctcaaagacttttgaaccaaaaactcatggatatgt-ggtaataaagcatattagatctcat |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46502110 |
ttatattgtacttaatcctcaaagacttttgaaccaaaaactcatggatatgtgggtaataaagcatattagatctcat |
46502188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University