View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9858_low_27 (Length: 262)
Name: NF9858_low_27
Description: NF9858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9858_low_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 1 - 170
Target Start/End: Complemental strand, 22702048 - 22701879
Alignment:
| Q |
1 |
acaatgtacctcgatactctcaattattggttttatctttaaggtcaataagaaattggcttgatcatcctgtagtgtttttagtatttcacttttatcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22702048 |
acaatgtacctcgatactctcaattattggttttatctttaaggtcaataagaaattggcttgatcatcctgtagtgtttttagtatttcacttttatcg |
22701949 |
T |
|
| Q |
101 |
agtatatatggcttaaaatctttgaatgtcaagttgtcattttcaagttgctactatccttcgatttctt |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22701948 |
agtatatatggcttaaaatctttgaatgtcaagttgtcattttcaagttgctactatccttcgatttctt |
22701879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 172 - 247
Target Start/End: Complemental strand, 22701844 - 22701766
Alignment:
| Q |
172 |
ctagtgatattaaaaatggagatagatatattacacttc---tagtagtattagttttcttccttagcaatgtctctat |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22701844 |
ctagtgatattaaaaatggagatagatatattacacttctattagtagtattagttttcttccttagcaatgtctctat |
22701766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University