View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9858_low_32 (Length: 248)
Name: NF9858_low_32
Description: NF9858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9858_low_32 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 1936639 - 1936390
Alignment:
| Q |
1 |
tctctcttttttgtgttaaactcgtgnnnnnnn--gtattaaatgtttaggacaggagtctcaatacatcagttttatggatttaatgatgatgccagat |
98 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1936639 |
tctctcttttttgtgttaaactcgtgtttttttttgtgttaaatgtttaggacacgagtctcaatacatcagttttatggatttaatgatgatgccagat |
1936540 |
T |
 |
| Q |
99 |
tttccaccagttttgcaaccaacaatctccacgctatcgataaaaatcatagagaagttcgaattgtcgttgttgaggaccgctatacttgtaaatcaat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1936539 |
tttccaccagttttgcaaccaacaatctccacgctatcgataaaaatcatagagaagttcgaattgtcgttgttgaggaccgctatacttgtaaatcaat |
1936440 |
T |
 |
| Q |
199 |
tttagagatgacaaatgttccaatcattcacgcaggttgtagatgtgaac |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1936439 |
tttagagatgacaaatgttccaatcattcacgcaggttgtagatgtgaac |
1936390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University