View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9858_low_35 (Length: 240)

Name: NF9858_low_35
Description: NF9858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9858_low_35
NF9858_low_35
[»] chr5 (2 HSPs)
chr5 (74-223)||(196002-196151)
chr5 (1-45)||(201466-201510)


Alignment Details
Target: chr5 (Bit Score: 146; Significance: 5e-77; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 74 - 223
Target Start/End: Complemental strand, 196151 - 196002
Alignment:
74 gatagttatttcactgaactgttggggaagtcagttactcagctctggactgactacaaaactaagtatatggcagtggcaccaactaactagaacggtt 173  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
196151 gatagttatttcactgaactgttggggaagtcagttactcagctctggactgactacaaaactaagtatatggcagtggcaccaactaactagaatggtt 196052  T
174 aattggttaataaagagataatgcattgggatagttaataaccgtgcatg 223  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
196051 aattggttaataaagagataatgcattgggatagttaataaccgtgcatg 196002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 201510 - 201466
Alignment:
1 ctttgctgcttaatttgatatgaactaattaattcctcctatata 45  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
201510 ctttgctgcttaatttgatatgaactaattaattcctcctatata 201466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University