View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9858_low_35 (Length: 240)
Name: NF9858_low_35
Description: NF9858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9858_low_35 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 5e-77; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 74 - 223
Target Start/End: Complemental strand, 196151 - 196002
Alignment:
| Q |
74 |
gatagttatttcactgaactgttggggaagtcagttactcagctctggactgactacaaaactaagtatatggcagtggcaccaactaactagaacggtt |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
196151 |
gatagttatttcactgaactgttggggaagtcagttactcagctctggactgactacaaaactaagtatatggcagtggcaccaactaactagaatggtt |
196052 |
T |
|
| Q |
174 |
aattggttaataaagagataatgcattgggatagttaataaccgtgcatg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
196051 |
aattggttaataaagagataatgcattgggatagttaataaccgtgcatg |
196002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 201510 - 201466
Alignment:
| Q |
1 |
ctttgctgcttaatttgatatgaactaattaattcctcctatata |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
201510 |
ctttgctgcttaatttgatatgaactaattaattcctcctatata |
201466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University