View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9858_low_43 (Length: 228)

Name: NF9858_low_43
Description: NF9858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9858_low_43
NF9858_low_43
[»] chr5 (1 HSPs)
chr5 (19-65)||(24124434-24124480)


Alignment Details
Target: chr5 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 65
Target Start/End: Original strand, 24124434 - 24124480
Alignment:
19 gtcctatgctagaatattttcatgttgaacctatctatatggaatgt 65  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
24124434 gtcctatgctagaatattttcatgttgaacctatctatatggaatgt 24124480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University